Resources
Related Projects Project Members |
GENERIC FEATURE FORMAT VERSION 3
SUMMARYAuthor: Lincoln Stein
Date: 23 May 2007
Version: 1.13
Although there are many richer ways of representing genomic features
via XML, the stubborn persistence of a variety of ad-hoc tab-delimited
flat file formats declares the bioinformatics community's need for a
simple format that can be modified with a text editor and processed
with shell tools like grep. The GFF format, although widely used, has
fragmented into multiple incompatible dialects. When asked why they
have modified the published Sanger specification, bioinformaticists
frequently answer that the format was insufficient for their needs,
and they needed to extend it. The proposed GFF3 format addresses the
most common extensions to GFF, while preserving backward compatibility
with previous formats. The new format:
1) adds a mechanism for representing more than one level
of hierarchical grouping of features and subfeatures.
2) separates the ideas of group membership and feature name/id
3) constrains the feature type field to be taken from a controlled
vocabulary.
4) allows a single feature, such as an exon, to belong to more than
one group at a time.
5) provides an explicit convention for pairwise alignments
6) provides an explicit convention for features that occupy disjunct regions
Online Validator
An online GFF3 validator is available at
http://dev.wormbase.org/db/validate_gff3/validate_gff3_online. It
is limited to files of 3,000,000 lines or less. If you wish to
validate larger files, please use the command-line version which
can be downloaded from the same site.
DESCRIPTION OF THE FORMAT
The format consists of 9 columns, separated by tabs (NOT spaces). The
following characters must be escaped using URL escaping conventions
(%XX hex codes):
tab
newline
carriage return
control characters
The following characters have reserved meanings and must be escaped
when used in other contexts:
; (semicolon)
= (equals)
% (percent)
& (ampersand)
, (comma)
Unescaped quotation marks, backslashes and other ad-hoc escaping
conventions that have been added to the GFF format are explicitly
forbidden
Note that unescaped spaces are allowed within fields, meaning that
parsers must split on tabs, not spaces.
Undefined fields are replaced with the "." character, as described in
the original GFF spec.
Column 1: "seqid"
The ID of the landmark used to establish the coordinate system for the
current feature. IDs may contain any characters, but must escape any
characters not in the set [a-zA-Z0-9.:^*$@!+_?-|]. In particular, IDs
may not contain unescaped whitespace and must not begin with an
unescaped ">".
Column 2: "source"
The source is a free text qualifier intended to describe the algorithm
or operating procedure that generated this feature. Typically this is
the name of a piece of software, such as "Genescan" or a database
name, such as "Genbank." In effect, the source is used to extend the
feature ontology by adding a qualifier to the type creating a new
composite type that is a subclass of the type in the type column.
Column 3: "type"
The type of the feature (previously called the "method"). This is
constrained to be either: (a) a term from the "lite" sequence
ontology, SOFA; or (b) a SOFA accession number. The latter
alternative is distinguished using the syntax SO:000000.
Columns 4 & 5: "start" and "end"
The start and end of the feature, in 1-based integer coordinates,
relative to the landmark given in column 1. Start is always less than
or equal to end.
For zero-length features, such as insertion sites, start equals end
and the implied site is to the right of the indicated base in the
direction of the landmark.
Column 6: "score"
The score of the feature, a floating point number. As in earlier
versions of the format, the semantics of the score are ill-defined.
It is strongly recommended that E-values be used for sequence
similarity features, and that P-values be used for ab initio gene
prediction features.
Column 7: "strand"
The strand of the feature. + for positive strand (relative to the
landmark), - for minus strand, and . for features that are not
stranded. In addition, ? can be used for features whose strandedness
is relevant, but unknown.
Column 8: "phase"
For features of type "CDS", the phase indicates where the feature
begins with reference to the reading frame. The phase is one of the
integers 0, 1, or 2, indicating the number of bases that should be
removed from the beginning of this feature to reach the first base of
the next codon. In other words, a phase of "0" indicates that the next
codon begins at the first base of the region described by the current
line, a phase of "1" indicates that the next codon begins at the
second base of this region, and a phase of "2" indicates that the
codon begins at the third base of this region. This is NOT to be
confused with the frame, which is simply start modulo 3.
For forward strand features, phase is counted from the start
field. For reverse strand features, phase is counted from the end
field.
The phase is REQUIRED for all CDS features.
Column 9: "attributes"
A list of feature attributes in the format tag=value. Multiple
tag=value pairs are separated by semicolons. URL escaping rules are
used for tags or values containing the following characters: ",=;".
Spaces are allowed in this field, but tabs must be replaced with the
%09 URL escape.
These tags have predefined meanings:
ID Indicates the name of the feature. IDs must be unique
within the scope of the GFF file.
Name Display name for the feature. This is the name to be
displayed to the user. Unlike IDs, there is no requirement
that the Name be unique within the file.
Alias A secondary name for the feature. It is suggested that
this tag be used whenever a secondary identifier for the
feature is needed, such as locus names and
accession numbers. Unlike ID, there is no requirement
that Alias be unique within the file.
Parent Indicates the parent of the feature. A parent ID can be
used to group exons into transcripts, transcripts into
genes, an so forth. A feature may have multiple parents.
Parent can *only* be used to indicate a partof
relationship.
Target Indicates the target of a nucleotide-to-nucleotide or
protein-to-nucleotide alignment. The format of the
value is "target_id start end [strand]", where strand
is optional and may be "+" or "-". If the target_id
contains spaces, they must be escaped as hex escape %20.
Gap The alignment of the feature to the target if the two are
not collinear (e.g. contain gaps). The alignment format is
taken from the CIGAR format described in the
Exonerate documentation.
(http://cvsweb.sanger.ac.uk/cgi-bin/cvsweb.cgi/exonerate
?cvsroot=Ensembl). See "THE GAP ATTRIBUTE" for a description
of this format.
Derives_from
Used to disambiguate the relationship between one
feature and another when the relationship is a temporal
one rather than a purely structural "part of" one. This
is needed for polycistronic genes. See "PATHOLOGICAL CASES"
for further discussion.
Note A free text note.
Dbxref A database cross reference. See the section
"Ontology Associations and Db Cross References" for
details on the format.
Ontology_term A cross reference to an ontology term. See
the section "Ontology Associations and Db Cross References"
for details.
Multiple attributes of the same type are indicated by separating the
values with the comma "," character, as in:
Parent=AF2312,AB2812,abc-3
Note that attribute names are case sensitive. "Parent" is not the
same as "parent".
All attributes that begin with an uppercase letter are reserved for
later use. Attributes that begin with a lowercase letter can be used
freely by applications.
THE CANONICAL GENE FIGURE 1
This section describes the representation of a protein-coding gene in
GFF3. To illustrate how a canonical gene is represented, consider
Figure 1 (figure1.png). This indicates a gene named EDEN
extending from position 1000 to position 9000. It encodes three
alternatively-spliced transcripts named EDEN.1, EDEN.2 and EDEN.3, the
last of which has two alternative translational start sites leading to
the generation of two protein coding sequences.
There is also an identified transcriptional factor binding site
located 50 bp upstream from the transcriptional start site of EDEN.1
and EDEN2.
Here is how this gene should be described using GFF3:
0 ##gff-version 3
1 ##sequence-region ctg123 1 1497228
2 ctg123 . gene 1000 9000 . + . ID=gene00001;Name=EDEN
3 ctg123 . TF_binding_site 1000 1012 . + . ID=tfbs00001;Parent=gene00001
4 ctg123 . mRNA 1050 9000 . + . ID=mRNA00001;Parent=gene00001;Name=EDEN.1
5 ctg123 . mRNA 1050 9000 . + . ID=mRNA00002;Parent=gene00001;Name=EDEN.2
6 ctg123 . mRNA 1300 9000 . + . ID=mRNA00003;Parent=gene00001;Name=EDEN.3
7 ctg123 . exon 1300 1500 . + . ID=exon00001;Parent=mRNA00003
8 ctg123 . exon 1050 1500 . + . ID=exon00002;Parent=mRNA00001,mRNA00002
9 ctg123 . exon 3000 3902 . + . ID=exon00003;Parent=mRNA00001,mRNA00003
10 ctg123 . exon 5000 5500 . + . ID=exon00004;Parent=mRNA00001,mRNA00002,mRNA00003
11 ctg123 . exon 7000 9000 . + . ID=exon00005;Parent=mRNA00001,mRNA00002,mRNA00003
12 ctg123 . CDS 1201 1500 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
13 ctg123 . CDS 3000 3902 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
14 ctg123 . CDS 5000 5500 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
15 ctg123 . CDS 7000 7600 . + 0 ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
16 ctg123 . CDS 1201 1500 . + 0 ID=cds00002;Parent=mRNA00002;Name=edenprotein.2
17 ctg123 . CDS 5000 5500 . + 0 ID=cds00002;Parent=mRNA00002;Name=edenprotein.2
18 ctg123 . CDS 7000 7600 . + 0 ID=cds00002;Parent=mRNA00002;Name=edenprotein.2
19 ctg123 . CDS 3301 3902 . + 0 ID=cds00003;Parent=mRNA00003;Name=edenprotein.3
20 ctg123 . CDS 5000 5500 . + 2 ID=cds00003;Parent=mRNA00003;Name=edenprotein.3
21 ctg123 . CDS 7000 7600 . + 2 ID=cds00003;Parent=mRNA00003;Name=edenprotein.3
22 ctg123 . CDS 3391 3902 . + 0 ID=cds00004;Parent=mRNA00003;Name=edenprotein.4
23 ctg123 . CDS 5000 5500 . + 2 ID=cds00004;Parent=mRNA00003;Name=edenprotein.4
24 Ctg123 . CDS 7000 7600 . + 2 ID=cds00004;Parent=mRNA00003;Name=edenprotein.4
Lines beginning with ## are pragmas that provide meta-information
about the document. Blank lines and lines beginning with a single #
are ignored.
Line 0 gives the GFF version using the ##gff-version pragma. Line 1
indicates the boundaries of the region being annotated (a 1,497,228 bp
region named "ctg123") using the ##sequence-region pragma.
Line 2 defines the boundaries of the gene. Column 9 of this line
assigns the gene an ID of gene00001, and a human-readable name of
EDEN. Because the gene is not part of a larger feature, it has no
Parent.
Line 3 annotates the transcriptional factor binding site. Since it is
logically part of the gene, its Parent attribute is gene00001.
Lines 4-6 define this gene's three spliced transcripts, one line for
the full extent of each of the mRNAs. These features are necessary to
act as parents for the four CDSs which derive from them, as well as
the structural parents of the five exons in the alternative splicing
set.
Lines 7-11 identify the five exons. The Parent attributes indicate
which mRNAs the exons belong to. Notice that several of the exons
share the same parents, using the comma symbol to indicate multiple
parentage.
Lines 12-24 denote this gene's four CDSs. Each CDS belongs to one of
the mRNAs. cds00003 and cds00004, which correspond to alternative
start codons, belong to the same mRNA.
Note that several of the features, including the gene, its mRNAs and
the CDSs, all have Name attributes. This attributes assigns those
features a public name, but is not mandatory. The ID attributes are
only mandatory for those features that have children (the gene and
mRNAs), or for those that span multiple lines. The IDs do not have
meaning outside the file in which they reside. Hence, a slightly
simplified version of this file would look like this:
##gff-version 3
##sequence-region ctg123 1 1497228
ctg123 . gene 1000 9000 . + . ID=gene00001;Name=EDEN
ctg123 . TF_binding_site 1000 1012 . + . Parent=gene00001
ctg123 . mRNA 1050 9000 . + . ID=mRNA00001;Parent=gene00001
ctg123 . mRNA 1050 9000 . + . ID=mRNA00002;Parent=gene00001
ctg123 . mRNA 1300 9000 . + . ID=mRNA00003;Parent=gene00001
ctg123 . exon 1300 1500 . + . Parent=mRNA00003
ctg123 . exon 1050 1500 . + . Parent=mRNA00001,mRNA00002
ctg123 . exon 3000 3902 . + . Parent=mRNA00001,mRNA00003
ctg123 . exon 5000 5500 . + . Parent=mRNA00001,mRNA00002,mRNA00003
ctg123 . exon 7000 9000 . + . Parent=mRNA00001,mRNA00002,mRNA00003
ctg123 . CDS 1201 1500 . + 0 ID=cds00001;Parent=mRNA00001
ctg123 . CDS 3000 3902 . + 0 ID=cds00001;Parent=mRNA00001
ctg123 . CDS 5000 5500 . + 0 ID=cds00001;Parent=mRNA00001
ctg123 . CDS 7000 7600 . + 0 ID=cds00001;Parent=mRNA00001
ctg123 . CDS 1201 1500 . + 0 ID=cds00002;Parent=mRNA00002
ctg123 . CDS 5000 5500 . + 0 ID=cds00002;Parent=mRNA00002
ctg123 . CDS 7000 7600 . + 0 ID=cds00002;Parent=mRNA00002
ctg123 . CDS 3301 3902 . + 0 ID=cds00003;Parent=mRNA00003
ctg123 . CDS 5000 5500 . + 2 ID=cds00003;Parent=mRNA00003
ctg123 . CDS 7000 7600 . + 2 ID=cds00003;Parent=mRNA00003
ctg123 . CDS 3391 3902 . + 0 ID=cds00004;Parent=mRNA00003
ctg123 . CDS 5000 5500 . + 2 ID=cds00004;Parent=mRNA00003
ctg123 . CDS 7000 7600 . + 2 ID=cds00004;Parent=mRNA00003
NOTE 1 - SOFA IDs: If using the SOFA IDs rather than the short names
("mRNA" etc), use the following mappings:
gene SO:0000704
mRNA SO:0000234
exon SO:0000147
cds SO:0000316
Other mRNA parts that you might wish to use are
intron SO:0000188 (redundant with exon)
polyA_sequence SO:0000610 (part of the three_prime_utr)
polyA_site SO:0000553 (part of the gene)
five_prime_utr SO:0000204
three_prime_utr SO:0000205
NOTE 2 - "Orphan" exons CDSs, and other features. Ab initio gene
prediction programs call hypothetical exons and CDS's that are
attached to the genomic sequence and not necessarily to a known
transcript. To handle these features, you may either (1) create a
placeholder mRNA and use it as the parent for the exon and CDS
subfeatures; or (2) attach the exons and CDSs directly to the gene.
This is allowed by SO because of the transitive nature of the part_of
relationship.
NOTE 3 - UTRs, splice sites and translational start and stop sites.
These are implied by the combination of exon and CDS and do not need
to be explicitly annotated as part of the canonical gene. In the case
of annotating predicted splice or translational start/stop sites
independently of a particular gene, it is suggested that they be
attached directly to the genomic sequence and not to a gene or a
subpart of a gene.
NOTE 4 - CDS features MUST have have a defined phase field. Otherwise
it is not possible to infer the correct polypeptides corresponding to
partially annotated genes.
NOTE 5 - The START and STOP codons are included in the CDS. That is,
if the locations of the start and stop codons are known, the first
three base pairs of the CDS should correspond to the start codon and
the last three correspond the stop codon.
REPRESENTING SPLICED NON-CODING TRANSCRIPTSFor spliced non-coding transcripts, such as those produced by some processed snRNAs and viruses, use a parent feature of "noncoding_transcript" and a child of "exon." PARENT (PART-OF) RELATIONSHIPSTHE GAP ATTRIBUTEALIGNMENTSTRANSCRIPT-RELATIVE ALIGNMENTSONTOLOGY ASSOCIATIONS AND DB CROSS REFERENCESTwo reserved attributes, Ontology_term and Dbxref, can be used to establish links between a GFF3 feature and a data record contained in another database. Ontology_term is reserved for associations to ontologies, such as the Gene Ontology. Dbxref is used for all other cross references. While there is no firm boundary line between these two concepts, curators tend to treat ontology associations differently and hence ontology terms have been given their own reserved attribute label. The value of both Ontology_term and Dbxref is the ID of the cross referenced object in the form "DBTAG:ID". The DBTAG indicates which database the referenced object can be found in, and ID indicates the identifier of the object within that database. IDs can contain unescaped colons but DBTAGs cannot, so parsing code should split on the first colon encountered in the attribute value. The format of each type of ID varies from database to database. An authoritative list of databases, their DBTAGs, and the URL transformation rules that can be used to fetch the objects given their IDs can be found at this location: ftp://ftp.geneontology.org/pub/go/doc/GO.xrf_abbs Further details can be found here: ftp://ftp.geneontology.org/pub/go/doc/GO.xrf_abbs_spec Here are some common examples: * a dbxref to an EMBL sequence accession number: Dbxref="EMBL:AA816246" * a dbxref to an NCBI gi number: Dbxref="NCBI_gi:10727410" * a Ontology_term referring to a GO association Ontology_term="GO:0046703" OTHER SYNTAX
Comments are preceded by the # symbol. Meta-data and directives are
preceded by ##. The following directives are recognized:
##gff-version 3
The GFF version, always 3 in this spec. This directive must
be present, and must be the topmost line of the file.
##sequence-region seqid start end
The sequence segment referred to by this file, in the format
"seqid start end". This element is optional, but strongly
encouraged because it allows parsers to perform bounds
checking on features. There may be multiple ##sequence-region
directives, each corresponding to one of the reference
sequences referred to in the body of the file.
##feature-ontology URI
This directive indicates that the GFF3 file uses the ontology
of feature types located at the indicated URI or URL.
Multiple URIs may be added, in which case they are
merged (or raise an exception if they cannot be merged). The
URIs for the released sequence ontologies are:
Release 1: 5/12/2004
http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.6
Release 2: 5/16/2005
http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
This directive may occur several times per file. If no
feature ontology is specified, then the most recent release of the
Sequence Ontology is assumed.
If multiple directives are given and a feature type is matched
by multiple ontologies, the matching ontology included by the
directive highest in the file wins the reference. The Sequence
Ontology itself is always referenced last.
The content referenced by URI must be in OBO or DAG-Edit
format.
##attribute-ontology URI
This directive indicates that the GFF3 uses the ontology of
attribute names located at the indicated URI or URL. This
directive may appear multiple times to load multiple URIs, in
which case they are merged (or raise an exception if merging
is not possible). Currently no formal attribute ontologies
exist, so this attribute is for future extension.
##source-ontology URI
This directive indicates that the GFF3 uses the ontology of
source names located at the indicated URI or URL. This
directive may appear multiple times to load multiple URIs, in
which case they are merged (or raise an exception if merging
is not possible). Currently no formal source ontologies
exist, so this attribute is for future extension.
###
This directive (three # signs in a row) indicates that all
forward references to feature IDs that have been seen to this
point have been resolved. After seeing this directive, a
program that is processing the file serially can close off any
open objects that it has created and return them, thereby
allowing iterative access to the file. Otherwise, software
cannot know that a feature has been fully populated by its
subfeatures until the end of the file has been reached. It
is recommended that complex features, such as the canonical
gene, be terminated with the ### notation.
##FASTA
This notation indicates that the annotation portion of the
file is at an end and that the remainder of the file
contains one or more sequences (nucleotide or protein)
in FASTA format. This allows features and sequences to
be bundled together. Example:
##gff-version 3
##sequence-region ctg123 1 1497228
ctg123 . gene 1000 9000 . + . ID=gene00001;Name=EDEN
ctg123 . TF_binding_site 1000 1012 . + . ID=tfbs00001;Parent=gene00001
ctg123 . mRNA 1050 9000 . + . ID=mRNA00001;Parent=gene00001;Name=EDEN.1
ctg123 . 5'-UTR 1050 1200 . + . Parent=mRNA00001
ctg123 . CDS 1201 1500 . + 0 Parent=mRNA00001
ctg123 . CDS 3000 3902 . + 0 Parent=mRNA00001
ctg123 . CDS 5000 5500 . + 0 Parent=mRNA00001
ctg123 . CDS 7000 7600 . + 0 Parent=mRNA00001
ctg123 . 3'-UTR 7601 9000 . + . Parent=mRNA00001
ctg123 . cDNA_match 1050 1500 5.8e-42 + . ID=match00001;Target=cdna0123+12+462
ctg123 . cDNA_match 5000 5500 8.1e-43 + . ID=match00001;Target=cdna0123+463+963
ctg123 . cDNA_match 7000 9000 1.4e-40 + . ID=match00001;Target=cdna0123+964+2964
##FASTA
>ctg123
cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg
tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta
tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa
aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat
aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat
cttaaatgtatttccgacgaattcgaggcctgaaaagtgtgacgccattc
gtatttgatttgggtttactatcgaataatgagaattttcaggcttaggc
ttaggcttaggcttaggcttaggcttaggcttaggcttaggcttaggctt
aggcttaggcttaggcttaggcttaggcttaggcttaggcttaggcttag
aatctagctagctatccgaaattcgaggcctgaaaagtgtgacgccattc
...
>cnda0123
ttcaagtgctcagtcaatgtgattcacagtatgtcaccaaatattttggc
agctttctcaagggatcaaaattatggatcattatggaatacctcggtgg
aggctcagcgctcgatttaactaaaagtggaaagctggacgaaagtcata
tcgctgtgattcttcgcgaaattttgaaaggtctcgagtatctgcatagt
gaaagaaaaatccacagagatattaaaggagccaacgttttgttggaccg
tcaaacagcggctgtaaaaatttgtgattatggttaaagg
For backward-compatibility with the GFF version output by the
Artemis tool, a GFF line that begins with the character >
creates an implied ##FASTA directive.
PATHOLOGICAL CASESThe following section discusses how to represent "pathological" cases
that arise in prokaryotic and eukaryotic genetics. Most of these have
to do with organisms' endlessly creative ways of processing
transcripts.
a) Single exon genes
This is the case in which a single unspliced transcript encodes a
single CDS.
----->XXXXXXX*------>
The preferred representation is to create a gene, a
transcript, an exon and a CDS:
ChrX . gene XXXX YYYY . + . ID=gene01;name=resA
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01
ChrX . exon XXXX YYYY . + . Parent=tran01
ChrX . CDS XXXX YYYY . + . Parent=tran01
Some groups will find this redundant. A valid alternative is to omit
the exon feature:
ChrX . gene XXXX YYYY . + . ID=gene01;name=resA
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01
ChrX . CDS XXXX YYYY . + . Parent=tran01
It is not recommended to parent the CDS directly onto the gene,
because this will make it impossible to determine the UTRs (since the
gene may validly include untranscribed regulatory regions).
Also note that mixing the two styles, as in the case of an organism
with both spliced and unspliced transcripts, is liable to lead to
the confusion of people working with the GFF3 file.
b) Polycistronic transcripts
This is the case in which a single (possibly spliced) transcript
encodes multiple open reading frames that generate independent protein
products.
----->XXXXXXX*-->BBBBBB*--->ZZZZ*-->AAAAAA*-----
Since the single transcript corresponds to multiple genes that can be
identified by genetic analysis, the recommended solution here is to
create four "gene" objects and make them the parent for a single
transcript. The transcript will contain a single exon (in the
unspliced case) and four separate CDSs:
ChrX . gene XXXX YYYY . + . ID=gene01;name=resA
ChrX . gene XXXX YYYY . + . ID=gene02;name=resB
ChrX . gene XXXX YYYY . + . ID=gene03;name=resX
ChrX . gene XXXX YYYY . + . ID=gene04;name=resZ
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01,gene02,gene03,gene04
ChrX . exon XXXX YYYY . + . ID=exon00001;Parent=tran01
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene01
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene02
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene03
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene04
To disambiguate the relationship between which genes encode which
CDSs, you may use the Derives_from relationship.
c) Gene containing an intein
An intein occurs when a portion of the protein is spliced out and the
two polypeptide fragments are rejoined to become a functional
protein. The portion that is spliced out is called the "intein," and
it may itself have intrinsic molecular activity:
----->XXXXXXyyyyyyyyyyXXXXXXX*-------
(yyyyyy is the intein)
The preferred representation is to create one gene, one transcript,
one exon, and one CDS. The CDS produces a pre-polypeptide using the
"Derives_from" tag, and this polypeptide in turn gives rise to two
mature_polypeptides, one each for the intein and the flanking protein:
ChrX . gene XXXX YYYY . + . ID=gene01;name=resA
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01
ChrX . exon XXXX YYYY . + . Parent=tran01
ChrX . CDS XXXX YYYY . + . ID=cds01;Parent=tran01
ChrX . polypeptide XXXX YYYY . + . ID=poly01;Derives_from=cds01
ChrX . mature_polypeptide XXXX YYYY . + . ID=poly02;Parent=poly01
ChrX . mature_polypeptide XXXX YYYY . + . ID=poly02;Parent=poly01
ChrX . intein XXXX YYYY . + . ID=poly03;Parent=poly01
Because the flanking mature_polypeptide has discontinuous coordinates
on the genome, it appears twice with the same ID.
If the intein is immediately degraded, you may not wish to annotate it
explicitly, and its line would be deleted from the example. However,
if it has molecular activity, it may correspond to a gene, in which
case:
ChrX . gene XXXX YYYY . + . ID=gene01;name=resA
ChrX . gene XXXX YYYY . + . ID=gene02;name=inteinA
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01,gene02
ChrX . exon XXXX YYYY . + . Parent=tran01
ChrX . CDS XXXX YYYY . + . ID=cds01;Parent=tran01
ChrX . polypeptide XXXX YYYY . + . ID=poly01;Derives_from=cds01
ChrX . mature_polypeptide XXXX YYYY . + . ID=poly02;Parent=poly01;Derives_from=gene01
ChrX . mature_polypeptide XXXX YYYY . + . ID=poly02;Parent=poly01;Derives_from=gene01
ChrX . intein XXXX YYYY . + . ID=poly03;Parent=poly01;Derives_from=gene02
The term "polypeptide" is part of SO. The terms "mature_polypeptide"
and "intein" are slated to be added in a pending release.
d) Trans-spliced transcript
This occurs when two genes contribute to a processed transcript via a
trans-splicing reaction:
spliced
leader
=======>----->XXXXXXX*------>
The simplest way to represent this is to show the mRNA as being split
across two discontinuous genomic locations:
ChrX . gene XXXX YYYY . + . ID=gene01;name=my_gene
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01
ChrX . exon XXXX YYYY . + . Parent=tran01
ChrX . CDS XXXX YYYY . + . ID=cds01;Parent=tran01
However, this does not indicate which part of the transcript comes
from the spliced leader. A preferred representation explicitly adds
features for the spliced leader gene, the primary_transcript and the
spliced_leader_RNA:
ChrX . gene XXXX YYYY . + . ID=gene01;name=my_gene
ChrX . gene XXXX YYYY . + . ID=gene02;name=leader_gene
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01,gene02
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01,gene02
ChrX . primary_transcript XXXX YYYY . + . ID=pt01;Parent=tran01;Derives_from=gene01
ChrX . spliced_leader_RNA XXXX YYYY . + . ID=sl01;Parent=tran01;Derives_from=gene02
ChrX . exon XXXX YYYY . + . Parent=tran01
ChrX . CDS XXXX YYYY . + . ID=cds01;Parent=tran01
As shown here, the mRNA derives from two genes ("my_gene" and the
leader gene) and occupies disjunct coordinates on the genome. The
primary_transcript, which encodes the body of the mRNA, is part of
(has as its Parent) this mRNA. The same relationship applies to the
spliced leader RNA. The Derives_from relationship is used to indicate
which genes produced the primary transcript and spliced leader
respectively.
The exon and CDS features follow in the normal fashion.
e) Programmed frameshift
This event occurs when the ribosome performs a programmed frameshift
during translation in order to skip over an in-frame stop codon. The
frameshift may occur forward or backward.
-------------------------> mRNA
==========
============* CDS
The representation of this is to make the CDS discontinuous:
ChrX . gene XXXX YYYY . + . ID=gene01;name=my_gene
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01;Ontology_term=SO:1000069
ChrX . exon XXXX YYYY . + . Parent=tran01
ChrX . CDS XXXX YYYY 0 + . ID=cds01;Parent=tran01
ChrX . CDS YYYY-1 ZZZZ 1 + . ID=cds01;Parent=tran01
You will also need to adjust the phase field properly so that the CDS
translates.
It is suggested that the mRNA be tagged with the appropriate SO
transcript attributes such as "minus_1_translational_frameshift"
(SO:1000069). This will allow all such programmed frameshift mRNAs to
be recovered with a query. The accession for
"plus_1_translational_frameshift" is SO:1001263.
f) An operon
A classic operon occurs when the genes in a polycistronic transcript
are co-regulated by cis-regulatory element(s):
regulatory element
* ================================================> operon
----->XXXXXXX*-->BBBBBB*--->ZZZZ*-->AAAAAA*-----
It can be indicated in GFF3 in this way:
ChrX . operon XXXX YYYY . + . ID=operon01;name=my_operon
ChrX . promoter XXXX YYYY . + . Parent=operon01
ChrX . gene XXXX YYYY . + . ID=gene01;Parent=operon01;name=resA
ChrX . gene XXXX YYYY . + . ID=gene02;Parent=operon01;name=resB
ChrX . gene XXXX YYYY . + . ID=gene03;Parent=operon01;name=resX
ChrX . gene XXXX YYYY . + . ID=gene04;Parent=operon01;name=resZ
ChrX . mRNA XXXX YYYY . + . ID=tran01;Parent=gene01,gene02,gene03,gene04
ChrX . exon XXXX YYYY . + . ID=exon00001;Parent=tran01
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene01
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene02
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene03
ChrX . CDS XXXX YYYY . + . Parent=tran01;Derives_from=gene04
The regulatory element ("promoter" in this example) is part of the
operon via the Parent tag. The four genes are part of the operon, and
the resulting mRNA is multiply-parented by the four genes, as in the
earlier example.
At the time of this writing, promoters and other cis-regulatory
elements cannot be part_of an operon, but this restriction is being
reconsidered.
|
|---|
Change Log:
1.13 Wed May 23 10:31:01 EDT 2007
-Insist that CDS include the start and end codon.
1.12 Thu Apr 5 17:32:32 EDT 2007
-Use "match_part" as the subpart of cDNA_match in the paired EST example.
-Phase is required for all CDS features.
1.11 Fri Dec 1 16:33:39 EST 2006
-Clarified definition of phase relative to reverse strand features
1.10 14 September 2006
-Reformatted for new SO web site.
1.09 Wed Sep 6 17:55:32 EDT 2006
-Information about the GFF3 validator.
1.08 Tue Jul 18 15:12:11 EDT 2006
-Added URLs for SO releases.
1.07 Wed May 24 21:59:02 EDT 2006
-Fixed description of phase (temporarily lost due to CVS glitches)
1.06 Wed May 24 11:44:22 EDT 2006
-Relaxed escaping rules.
-Fixed typos found by Gordon Gremme.
1.05 Tue May 23 10:46:25 EDT 2006
-Fixed all IDs in the examples to make them internally consistent. Previously,
some examples did not validate because of inconsistent numbers of zeroes in
the identifiers (mRNA00001 vs mRNA0001).
|
Maintained on SourceForge. |
Supported by a grant from the National Human Genome Research Institute. |
Member of the Gene Ontology Consortium. |
| Contact SO | ||